| Primary Identifier | MGI:5911092 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wnk2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGATAGAGACTTCACCC, TTCACCCTGGAGCCCCTGCG, CAGCCTTGAGTGACAAGACC and CAAGCCTCACCCAGCAGACC, which resulted in 2 small deletions, a 7 bp (GGCTGAG) deletion beginning at Chromosome 13 positive strand position 49,060,745 bp and ending after 49,060,752 bp, followed 27 bp later by a 6 bp deletion (GTGGAG) beginning at Chromosome 13 positive strand position 49,060,753 bp and ending after 49,060,759 bp (GRCm38/mm10). This mutation deletes 13 total bases in ENSMUSE00000642194 (exon 20) and is predicted to cause a change of amino acid sequence after residue 1538 and early truncation 9 amino acids later. |
