| Primary Identifier | MGI:5912016 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Efcab7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACGTAGCCATCAATCAGTG, TCACTAGGTCACTTGGGGCT, TCTAGTAGATTTTTACTGCT and ATCTCAGGTTATCAACAATA, which resulted in a 500 bp deletion beginning at Chromosome 4 positive strand position 99,877,875 bp and ending after 99,878,374 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001051035, ENSMUSE00000631831 (exons 2,3) and 220 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is 7 bp insertion at the deletion site (AAGGGGG) that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 77 and early truncation 20 amino acids later. |
