|  Help  |  About  |  Contact Us

Allele : Csnk1g1<em1(IMPC)J> casein kinase 1, gamma 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5912107 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Csnk1g1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTGGGAACTATTACTGGG, CTCAGTTTAACTTTTCCAGG, GGTTACAGAGGGTTAACTGA and GCAGCTAATACATCATTAAA, which resulted in a total of 611 bp deletion beginning at Chromosome 9 positive strand position 65,999,223 bp for 48 bp where there is an endogenous 3 bp retention (GGA) followed by 563 bp deletion ending after 65,999,836 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221266 (exon 6) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 29 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele