| Primary Identifier | MGI:5912117 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adgrf3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTAAGAATCTGAATTCTGA, CTTTCTAGAGACCTCCAGCA, GTACAGGGATAACAAAGAAG and ATGTGGGCCTTGGGTCCAGT, which resulted in a 575 bp deletion beginning at Chromosome 5 negative strand position 30,199,382 bp and ending after 30,198,808 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000601748 (exon 8) and 378 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 346 and early truncation 17 amino acids later. |