|  Help  |  About  |  Contact Us

Allele : Zfp407<em1(IMPC)J> zinc finger protein 407; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5907859 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp407
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCTGGCTCTCACAGCAA, TTACCATAACAAAGGGAAGG, GCAGTTCTCACCTAGACTGA, and TGTATGGGTGAGATAATTAT, which resulted in a 423 bp deletion beginning at Chromosome 18 negative strand position 84,553,166 bp, GTGAGATAATTATGGGAATA, and ending after TGCGTATCCTCCTTCCCTTT at 84,552,744 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220921 (exon 3) and 308 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1554 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Zfp407<->,
  • Zfp407<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele