| Primary Identifier | MGI:5907864 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Stk35 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACCGTCTCGAATTGAACGG, GGAACCACCGGGAAGTACCG, TGTTAGGGAATGTCAGCTAA and GGATGAAGAGTAGTCCTGGT, which resulted in a 1047 bp deletion beginning at Chromosome 2 positive strand position 129,801,227 bp TACTTCCCGGTGGTTCCGTC, and ending after AGATGGATGAAGAGTAGTCC at 129,802,273 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001092478 (exon 2) and 446 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 63 amino acids later. |
