| Primary Identifier | MGI:5907831 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rgsl1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTCTAGCAGTACACTATG, TGGGAGATCTTTGCTTAATG, CATTTCTGTCCATAGTTTGG and CAAGCTTTCATCTTTGAAAT, which resulted in a 321 bp deletion spanning ENSMUSE00001254521 (exon 12) beginning at Chromosome 1 negative strand position 153,804,855 bp, CTCATGAAACCACCAAACTA, and ending after AAGCCACATTAAGCAAAGAT at 153,804,535 bp (GRCm38/mm10). This mutation deletes exon 12 and 203 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 707 and early truncation 43 amino acids later. |