|  Help  |  About  |  Contact Us

Allele : Zfp385b<em1(IMPC)J> zinc finger protein 385B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5907974 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp385b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGATATGTTTCCCTCAC, AACACATATTGCTTCCTGTG, CACCTCGTAGATAAATGCTG, and AGGAAGGTGAGACCAGTCAA, which resulted in a 447 bp deletion beginning at Chromosome 2 negative strand position 77,450,461 bp, ACCTCGTAGATAAATGCTGG, and ending after ATATGATATGTTTCCCTCAC at 77,450,015 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000326653 (exon 4) and 284 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp intronic deletion (GTTGACTG) 108 bp before the 447 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 67 and early truncation 5 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele