| Primary Identifier | MGI:5925303 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cacna2d4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCAGATGTCAGATCCTCAA, TCTGACATCTGATCGTGATA, GCAGGGAGACTCTACTTACA and GGGGCTCAAACACAGTCAGA, which resulted in a 173 bp deletion beginning at Chromosome 6 positive strand position 119,238,969 bp and ending after 119,239,141 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332836 (exon 2) and 91 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 8 amino acids later. |
