| Primary Identifier | MGI:5925317 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pkmyt1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGTTATCATTGCACGCAG, AATGGTAGTCCCCCAAACCA, GCTGATCAGCCACCAACAAA and GTAGTCCCAGATGTTAACTG, which resulted in a 1036 bp deletion beginning at Chromosome 17 positive strand position 23,733,561 bp and ending after 23,734,596 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136277 (exon 3) and 542 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 10 amino acids later. |
