| Primary Identifier | MGI:6140010 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mak16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACACGACAATTTATAAA, GCAATTTTGCTTTTGCCCAA, GTTGCTGGAGCCTACAGTGA and TTCATGTTAGGGGACGAGCG, which resulted in a 392 bp deletion beginning at Chromosome 8 position 31,166,493 bp and ending after 31,166,884 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000210909 and ENSMUSE00000210910 (exons 2 and 3) and 232 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 6 amino acids later. |
