| Primary Identifier | MGI:5927759 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Krt23 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGGATTATAACTAAAGGG, TATCACGTGCACGTGTACCT, GTTCACGGAATTATTCCAGT and CAGTGGCTCTTGAACATATA, which resulted in a 276 bp deletion beginning at Chromosome 11 positive strand position 99,486,564 bp and ending after 99,486,839 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000112592 (exon 2) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 1 amino acid later. |
