| Primary Identifier | MGI:5927681 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Map7d1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACACTATACACAAGGCGGT, TGGAAGTGCTGGCAGACGGG, GGAAGTGACTCAAGTCCATG and GATAGGGATCTATCACACAT, which resulted in a 325 bp deletion beginning at Chromosome 4 negative strand position 126,240,320 bp and ending after 126,239,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364976 (exon 5) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GGC) 59 bp after the 325 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 210 and early truncation 9 amino acids later. |
