| Primary Identifier | MGI:6093478 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gpr137 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCTCTATACTGGACCAAG, TCTGCTGCCGTAACTGTCCC, TGACTCCTCAGGAGACCCCA and GTGAGGGCCGAGGGGATCCG, which resulted in a 841 bp deletion beginning at Chromosome 19 negative strand position 6,939,821 bp and ending after 6,938,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000146635, ENSMUSE00000146628, ENSMUSE00000146634 (exons 3,4,5) and 505 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and read through the stop with a new stop 204 amino acids later. |
