| Primary Identifier | MGI:6094272 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gpr150 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCCTAGAAGGCACTTTCAC, CAGGGCGGCGGTCTGGGGCG, TTCAGAATTGCGAGGCTGAA and ATGCGGGATTCAGAATTGCG, which resulted in a 1267 bp deletion beginning at Chromosome 13 negative strand position 76,056,814 bp and ending after 76,055,548 bp (GRCm38/mm10). This mutation causes an internal deletion of ENSMUSE00000362291 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and stop 4 amino acids later. |
