| Primary Identifier | MGI:5925402 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hspb9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGCGGGTGCGAAGAGGAA, CGGGGCGGGTGCGAAGAGGA, TCGTTTTGTAAGGAGCTCTT and CCAGTCCCAGAAACCCAGGA, which resulted in a 296 bp deletion beginning at Chromosome 11 positive strand position 100,713,863 bp and ending after 100,714,158 bp (GRCm38/mm10). This mutation generates an internal deletion in ENSMUSE00000891702 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 18 amino acids later. |
