|  Help  |  About  |  Contact Us

Allele : D5Ertd579e<em1(IMPC)J> DNA segment, Chr 5, ERATO Doi 579, expressed; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6158654 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  D5Ertd579e
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCTTGACAAGGACAGAAAA, ATTATTTTATGTCACTACGG, ACACTGAGAAGGACCCTGTA and GAATCCCAGAGTTTAAAAAC, which resulted in a 242 bp deletion beginning at Chromosome 5 position 36,619,631 bp and ending after 36,619,872 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300199 (exon 4) and 175 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a (CCAAG) 5 bp insertion and a 17 bp deletion (TTTTCTGTCCTTGTCAA) 220 bp after the 242 bp deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 7 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele