| Primary Identifier | MGI:6158658 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nup153 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GGTCAGATGCTATCACACTC and ATACCAAGATCTAGATTTAG, which resulted in a 447 bp deletion beginning at Chromosome 13 position 46,717,030 bp and ending after 46,717,476 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000456072 (exon 2) and 224 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 14 amino acids later. |