| Primary Identifier | MGI:6158662 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Palmd |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACCGAGCTCCTTCCCTAAAA and AGTCTTATGCATGGCGACAG, which resulted in a 266 bp deletion beginning at Chromosome 3 position 116,947,864 bp and ending after 116,948,129 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323056 (exon 3) and 141 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (GT) 11 bp after the 266 bp deletion that will not alter the results of the 266 bp deletion. The 266 bp deletion is predicted to cause a change of amino acid sequence after residue 42 and early truncation 1 amino acid later. |
