|  Help  |  About  |  Contact Us

Allele : Svopl<em1(IMPC)J> SV2 related protein homolog (rat)-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6111442 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Svopl
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Svop1-111592J-4927M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGCTTGCAGCTACTCCACG, AATTCAAGACTCCATCTTAG, ATACCTGTAGAGGTGGGCCA and GGCAGAGTATGAGAACCACT, which resulted in a 376 bp deletion beginning at Chromosome 6 negative strand position 38,041,189 bp and ending after 38,040,814 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309504 (exon 3) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 27 and early truncation 19 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele