| Primary Identifier | MGI:6101177 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Stk33 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGAGCTTGGTAATGCAAG, GAATGATCATGACGTTTTCA, GCTACTGTCCTGAATACACG and GCCTCTCTTCCACAGACCCA, which resulted in a 454 bp deletion beginning at Chromosome 7 negative strand position 109,331,843 bp and ending after 109,331,390 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000205668 (exon 7) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 181 and early truncation 1 amino acid later. |
