| Primary Identifier | MGI:6107621 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc2a7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTCACTTCTAGGATTGGGG, GCCTCCACTTCCTCTTTAGG, TAGATGCCCCTAGTCCTTAG and AGCAATGTCATCTTTTCTAG, which resulted in a 324 bp deletion beginning at Chromosome 4 positive strand position 150,149,378 bp and ending after 150,149,701 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463885 (exon 2) and 214 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 15 amino acids later. |
