| Primary Identifier | MGI:6104251 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mfsd4b4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTACAACTCAGCTCTAAATG, CAGGGCCCATCGAGTTCCCA, TTATGACTAGAAGGCCACTG and ACTGTAACAAAACCACAGGA, which resulted in a 388 bp deletion beginning at Chromosome 10 negative strand position 39,895,021 bp and ending after 39,894,634 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001308224 (exon 2) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 21 amino acids later. |
