|  Help  |  About  |  Contact Us

Allele : Ribc2<em1(IMPC)J> RIB43A domain with coiled-coils 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6104255 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ribc2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGAGGGCTTCACAGAGTAG, AAAGGTTCCCTTCCCATACG, GATAACTGCTTCTTCTTGAG and AGAGGCCGTAAGAAATAGCT, which resulted in a 345 bp deletion beginning at Chromosome 15 positive strand position 85,132,649 bp and ending after 85,132,993 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000126475 (exon 2) and 263 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele