| Primary Identifier | MGI:6114793 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Coq3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTATTGCAAATGATAAGCAA, GAGTTTCTTTGGGATAACAA, GAGTTTCTTTGGGATAACAA and CCAGTATGTTAAAGCTTATG, which resulted in a 559 bp deletion beginning at Chromosome 4 positive strand position 21,892,681 bp and ending after 21,893,239 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340164 (exon 2) and 432 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 42 amino acids later. |
