| Primary Identifier | MGI:6143823 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mprip |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTGCTCAGTGAGGAATGCTA, GCCAAGCTGGACTTATGTAG, GTATCAGGCAGCCTGCGTGG and ACACGGGACGTTTCTCAAAG, which resulted in a 655 bp deletion beginning at Chromosome 11 position 59,727,305 bp and ending after 59,727,959 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001091723 (exon 4) and 503 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 33 amino acids later. |
