| Primary Identifier | MGI:6143833 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Relch |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGCATCCAACCAAGAAAA, TGCGTTCACAAGTTTCATAA, GTAGTTTCTAAAATCAAAGC and TCAGGCTATAAAAAGTTACC, which resulted in a 696 bp deletion beginning at Chromosome 1 position 105,686,903 bp and ending after 105,687,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370997, ENSMUSE00000385562, ENSMUSE00000348886 (exons 3,4,5) and 454 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (T) insertion and 7 bp deletion (ATAAAGG) 83 bp before the 696 bp deletion that will not affect the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 205 and early truncation 2 amino acids later. |
