| Primary Identifier | MGI:6147563 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tspan9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTAAAACCCTGAAAGCAGG, CCTGTAAAGCTGGTGACCCG, TCAGTGTTCAGTGAGACGAA and GCCTCGTCCCATTTACTGTA, which resulted in a 2472 bp deletion beginning at Chromosome 6 position 127,965,063 bp and ending after 127,967,534 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254362, ENSMUSE00000197715, ENSMUSE00000197720, ENSMUSE00000197719, ENSMUSE00000239192 (exons 4, 5, 6, 7, and 8) and 1887 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is an 8 bp deletion (CTGCTTTC) 70 bp after the 2472 bp deletion that will not affect the results of the deletion. This mutation is predicted to cause an in-frame deletion of 195 amino acids after amino acid residue 21 and retain the last 23 amino acids in-frame. |