| Primary Identifier | MGI:6147545 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ralgapa1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATTAAGTTCTTCAAAAGGC, TATGCTAAGGAGTAGTGAGA and TTTAGACAAATGCTAAATCA, which resulted in a 313 bp deletion beginning at Chromosome 12 position 55,794,879 bp and ending after 55,795,191 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370584(exon 3) and 263 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (TGAG) 15 bp before the 313 bp deletion that will not alter the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 17 amino acids later. |
