| Primary Identifier | MGI:6149736 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam24b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GTGGTATAAGAAATATAACT and GCCTTCTCTATTATCCTCCT, which resulted in a 648 bp deletion beginning at Chromosome 7 position 131,325,916 bp for 46 bp to 131,325,962 bp retaining 3 bp, TTA, and then an additional 602 bp deletion ending after 131,326,566 (GRCm38/mm10). This mutation deletes ENSMUSE00001326894 (exon 4) and 267 bp of flanking intronic sequence including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 10 amino acids later. |
