| Primary Identifier | MGI:6149988 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ankrd28 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACTTTAAGCACCCAAAAC, ATGGAACTAATAAGTCTGTA, GGGTGGTTTGGCTCAAGCCA and AGTCTCGCCAACAAAATCTT, which resulted in a 385 bp deletion beginning at Chromosome 14 position 31,764,067 bp and ending after 31,764,451 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349484 (exon 3) and 306 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 29 bp intronic deletion, Chr 14 :31,764,516 -31,764,544, which is 64 bp before the 385 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later. |
