| Primary Identifier | MGI:6150882 | Allele Type | Transgenic |
| Attribute String | Knockdown, Reporter | Gene | Tg(Thy1-EGFP/RNAi:Sumo)27Weiy |
| Strain of Origin | FVB/N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The transgene was designed to have (from 5' to 3') the ~6.5 kbp mouse Thy1 promoter for neuron-specific expression (Thy1 sequences extending from the promoter to the intron following exon 4, excluding exon 3 and its flanking introns), EGFP, a fragment containing three chained pre-miRNA sequences (AATCGAATCTGCCTCATTGAC, GTTTGTCAATGAGGCAGATCA, GGTCAGAGAATTGCTGATAAT) that target/silence SUMO3, SUMO2 and SUMO1 (respectively) and a polyadenylation signal. Six founder lines were generated, founder 27 exhibits widespread expression in the brain. |
