| Primary Identifier | MGI:6151437 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eml4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TTGTAAAACTCTGCTCCTTA and TCATCATGCACAGTTGTTCA, which resulted in a 216 bp deletion beginning at Chromosome 17 position 83,421,557 bp and ending after 83,421,772 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000484417 (exon 3) and 86 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 43 amino acids later. |