|  Help  |  About  |  Contact Us

Allele : Smg5<em1(IMPC)Mbp> SMG5 nonsense mediated mRNA decay factor; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis

Primary Identifier  MGI:6152647 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Smg5
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 4 guide sequences AGTGGGTGCAGTACATGCAGGGG, GTAACACAGCTCTAAGGCTGTGG, CCTCATGGTACTCTAGTGAAGTC, CCCTGAGAGAACAGATGAGAATC, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele