|  Help  |  About  |  Contact Us

Allele : Vgf<em1(IMPC)Wtsi> VGF nerve growth factor inducible; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute

Primary Identifier  MGI:6153761 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Vgf
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence GGAGAGCGCCTGCTTCAGCAAGG, and a donor oligo, which resulted in a Point Mutation allele.
  • mutations:
  • Single point mutation
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele