| Primary Identifier | MGI:6153953 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ap2a1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCATGCTGCAGACCGCACTGACA, CCCTCGTGTACCCTGCATTGCTA, CCCACGGCCAGTGTGACAGCACA and ACGTGACCAGGATATTACATAGG, which resulted in a 934 bp deletion beginning at Chromosome 7 position 44,909,004 bp and ending after 44,909,937 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000491996 and ENSMUSE00000497958 (exons 5 and 6) and 702 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 23 amino acids later. |