|  Help  |  About  |  Contact Us

Allele : Slc39a10<em1(IMPC)J> solute carrier family 39 (zinc transporter), member 10; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6162488 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc39a10
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 4 guide sequences GTATGAGTACTACCTTAAAG, ATTTTTTGCATAAATTCCTA, TATTTCCTCTGGCCCTGTAG and TCTGATCCTGTATGAATCTT, which resulted in a 521 bp deletion beginning at Chromosome 1 position 46,832,525 bp and ending after 46,833,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001325787 (exon 3) and 313 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (A) insertion 164 bp after the exon deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 338 and early truncation 19 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele