| Primary Identifier | MGI:6162500 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmc4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACCAGACCTTTTCCCAA and GAGTCAGCGTCAGAAAATGA, which resulted in a 277 bp deletion beginning at Chromosome 7 position 3,675,326 bp and ending after 3,675,602 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001301550 (exon 3) and 131 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 6 amino acids later. |
