| Primary Identifier | MGI:6156424 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atp8b1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0945 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AACTCCAAGTGGGTAGGGTC and AAAATCGAGTATCCACCACC targeting the 5' side and CTAGAAGTCTATGGCACATT and TGCATTGCTGCAGGTACATA targeting the 3' side of critical exons resulting in a 493-bp deletion Chr18:64577258 to 64577750 (GRCm38). |
