|  Help  |  About  |  Contact Us

Allele : Iars2<em1(IMPC)Tcp> isoleucine-tRNA synthetase 2, mitochondrial; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156430 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Iars2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0561 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AATTACCAGTGTGTTTTGGG and CATAGACCCTTATCAATACC targeting the 5' side and TTAAACCTTCCTGTCAAACC and AAAAGTCCGGGATTATATGG targeting the 3' side of exon ENSMUSE00001307419 and ENSMUSE00001291581. This allele has two deletion junctions. The first is simply within gRNA_U5 and is a 9-bp deletion Chr1:185328265 to 185328257 in the intron immediately preceding the critical region. The second deletion encompasses the critical region from gRNA_U3 to gRNA_D3 and is a 2,481-bp Chr1:185325328 to 185327808_insGAGT. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele