| Primary Identifier | MGI:6156446 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fer |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1002 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) having spacer sequences of GTACCAGTCATGCTCCGCCA targeting the 5' side and CTGTATATTCTGACGGACAA targeting the 3' side leading to the a 140-bp del from Chr17:63981519 to 63981658. (GRCm38) |
