| Primary Identifier | MGI:6156457 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tagln2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0973 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAAGATCCAGGCCTCTTCGATGG, GCGCTATGGCATTAACACCACGG, CCTCGGAACTTCTCGGACAACCA, and GCATCTCAGGCCGGCATGACCGG targeting a critical region. This resulted in a inter-exon deletion of 909 bp Chr1:172505828 to 172506736; predicted to cause p.S84fs* (GRCm38). |
