| Primary Identifier | MGI:6156473 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Golph3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0906 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGTACTTACCCAAGTCAAT and GGAAGGGTCGTCCTTTTACC targeting the 5' side and ACCGTTTACTCTGTTTAGAG and CGTTATGTTTTGTACACCAG targeting the 3' side leading to a 4435-bp deletion from Chr15:12339050 to 12343484_insATAATTATGAGTAAACTCT (GRCm38). |
