| Primary Identifier | MGI:6156477 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab39b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0620 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of TGTCATCGGCGATTCCACGG, CACCGAGGGCCGCTTTGCTC, and ACGCATCAAGCTCCAGATCT targeting exon ENSMUSE00000385171. This resulted in a 133-bp deletion of ChrX from 75577825 to 75577957 (gRNA_U to gRNA_D). This mutation is predicted to cause a frameshift with the amino acid changes after residue 18 and early truncation 20 amino acids later (p.T18Sfs*22). (GRCm38). |
