|  Help  |  About  |  Contact Us

Allele : Rab39b<em1(IMPC)Tcp> RAB39B, member RAS oncogene family; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156477 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rab39b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0620 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of TGTCATCGGCGATTCCACGG, CACCGAGGGCCGCTTTGCTC, and ACGCATCAAGCTCCAGATCT targeting exon ENSMUSE00000385171. This resulted in a 133-bp deletion of ChrX from 75577825 to 75577957 (gRNA_U to gRNA_D). This mutation is predicted to cause a frameshift with the amino acid changes after residue 18 and early truncation 20 amino acids later (p.T18Sfs*22). (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele