| Primary Identifier | MGI:6156546 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trim16 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1018 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTCATGACCCCGCAGAGGTC targeting the 5' side and CCAGCTAACCGAACCCGCAA targeting the 3' side of a critical region. This resulted in a 160-bp deletion Chr11:62820676 to 62820835; (predicted effect on protein p.V58Pfs*71) (GRCm38). |
