|  Help  |  About  |  Contact Us

Allele : Prdm13<em1(IMPC)Tcp> PR domain containing 13; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156585 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prdm13
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0446 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CTGAGCAGCTACTAGAGGCT and TGAGCCTGGCTGTGGCACAT targeting the 5' side and TCTTGCTCACCCTCGCTGTT and GCCTAGAGCTCATAAGCGAA targeting the 3' side of exons ENSMUSE00001302781 (exon 2) and ENSMUSE00001204778 (exon 3). This resulted in a 854 bp deletion of Chr4 from 21683245 to 21684098. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele