|  Help  |  About  |  Contact Us

Allele : Cyp21a1<em1(IMPC)Tcp> cytochrome P450, family 21, subfamily a, polypeptide 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156596 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cyp21a1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0692 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTAGCACCACCACATCTGAG and GGCCGACCCCATATGCTAAA targeting the 5' side and CAGATCGCTTCCTGGAACCT and GTGAGCGTCCTTGACAGGAT targeting the 3' side of a set of critical exons. This resulted in a 2104-bp deletion of Chr17 from 34802035 to 34804138 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele