| Primary Identifier | MGI:6156602 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pah |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR829 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACTATGCTTGAAGTCCGTGC and TGGGCTGCCCACTAGAATAC targeting the 5' side and TGGGCTGCCCACTAGAATAC and TCACACCTAACATTCTTGCA targeting the 3' side of a critical region. This resulted in a 317-bp deletion Chr10:87567166 to 87567482 (GRCm38). |