| Primary Identifier | MGI:6157328 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dnajc13 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGCTTTCTAGACTCTCGA, GTTCCCACTAAAATAAGTGG, CTGACTTCAGCAGGGAAGAT and ATAGTTCCCACTAAAATAAG, which resulted in a 495 bp deletion beginning at Chromosome 9 position 104,238,263 bp and ending after 104,238,757 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000395222 (exon 3) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 35 amino acids later. |
