|  Help  |  About  |  Contact Us

Allele : Mcidas<em2(IMPC)Tcp> multiciliate differentiation and DNA synthesis associated cell cycle protein; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6157333 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mcidas
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0506 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs having spacer sequences of CCATTCGAGAGGTAAGGATG and ACAGTAGGCTTGCCTTGGGC targeting the 5' side and GGGACAGACGTTAAGTAAAA and TTGCTTCAGGTTAGCTCAGC targeting the 3' side of a critical region. This resulted in a 699-bp deletion of Chr13 from 112996485 to 112997183 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele